EST 1235427 is a singleton


Sequence

>1235427 (1 EST) Length=896 GTGAAACAGCAAAAATATGACTTACACATCAAAAGTAGACGATGAAATACGCAAACGATTCGATTTCCCGAAAGTAGAAT TACATCTACATTTGGATGGTGCTATAAGACATCAAACCTTACTTGACCTTTCCATGTAAATTTTGATTAGTTTCCGTTTT TTATTTTATTTTATTTTATTTATAAAAAATGCTTTAATAGGCTGAAGTTTGTGTGTTTCTAGATAATCATCATTAAAATT TTAATGTATAGCGGTGATACTGTAAAAGTTAAATCAATCTTATCGTAGATTCTGCAAAAGGTTATGTTAAAAAAAGATCA AAGTTTTGCTTGTTCCTAAACAATCATCATTAAAATATTTCTGTTTGACGGTGACACTATGAAAATTAAATCAATCTTAA TTTCATTTTTGTGAAACGGAAAGTCAAAAACGAAAACCTTTCATAAAAAAGTGTTAAGGACATTTTGGTTGATTAAATAC ATTCATCTTAACCAATAAATGTATTATTTATTCGATAAGGTAATTTTTAATCTGTTAGCATTTATTTAAAATTTTCTACT TATTCTTAATTTATCATTACCTAATAGCTTTAAGGGCCATTTTGATTAANCATTGTTGTGTATGCGATTGATTAAATTCA TTTCATAACCCGCTTAACTGAAATGTTTTTCTTTCCATTAATTATCACTAATTGAATATTCAAATAAAAAATAATTTGAA TTTTTTTAGTGAAAAAAAAANTGATTTAAAAGGAATGACACCGCTGATGAAATTCGCGANATGTGTTACTCNTGANCATC AANTTATCTAAATGCTGGAACCATTGATTATTCTCCNCTCCTGCAGGTANANGACCCATGAACAACGCTNNAATTTCNAG ANAAGCCAAATGGNTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1235427: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12354272369522AA584969SWMFCA2704SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 11:35:15 on Wed 22 Nov 117.