EST 1235429 is a singleton


Sequence

>1235429 (1 EST) Length=290 GTAAGTCCAAGGTTAATTTATCCAGCAAATGAGGCACATTCAATCATTGAATTCAATACTTGNTTTGTTATACATTTGTT GACCATATTCTCTGGTCTCGTTTTGTAGCACAGTAAGTAAAACTTTTTTAACCATACTTTTCAGGTAATTAAATTCCGAT TTATTGCTACGTTTTCATCCTTTCATTTTTGTCTGAGAAATTTTCACTTTTCTCGTTTAATTTAATTAACTTCTTCATTG TTTGACGGTGGATATGAAACGTCAATTAATTTGTCGAGAATTTTATTGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1235429: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12354292369524AA584971SWMFCA2707SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 19:53:21 on Fri 17 Nov 117.