EST 1235449 is a singleton


Sequence

>1235449 (1 EST) Length=384 TTGCCTCAGCTGAAGCGAATGTCAGGGACTCTCGAAGTGGAGGGTATTTGATAAAGCCATGCGTGAGTACAGTATTCTTG AAGATGTAATCGCTGATCAAAGGCGCTACTTTACTTCATCGATGTTTCCCCCAAACGATGACGAAATTCGGAATTTTCAT TTGGAACGCTGTTTTCGAATATTACCACACTTGCAAAATACTGGAGGATTTTTTGTTGCGTGCGAGAAAATTAAAAACCG CTTAACCAAATGACAAACTGCTTTCATTTGCGTCAAGAAAGCATCAACATCAGAGATCATTGTATTCTGAAGACATGCGC ATGAGATATGCATCGTACGATTCGAGGTCCTACACTTGTAAGCTACATAAACGAGTATCTACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1235449: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12354492369544AA584991SWMFCA2812SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 5:45:3 on Sun 19 Nov 117.