EST 1235460 is a singleton


Sequence

>1235460 (1 EST) Length=545 GAGATTCTTATAATTTTGATACAGATCTTGGTTTACTAATATGGACAAAATTCTGCCAGTTAATTTAAAGTTGTGGTGGA TGGATTGGTTTCTCGAAAAAACGTTATGNGATNGATGAAACCANAGTTGGGANATTCATGGGGGAAGATANGTTCGGCAA TNAATACTACGAANACAATTCATATTTTATGCCCCGAATTNGCTGGGTCGAATATCCANAACATGTGTGGGNNGATTACG ACGCTTCTCNNATTCCTGCTGAATGGCACATGTGGTTGCATCATATTACCGATGAAACTCCTGTTCAGAATCCTCCAAAG CAGANGAAGTGGATGTTGGATCATGANGAGACCTTGACTTTACTGGAAAATCGGAAGTATTACCCTTATTCGACAACAAA ACAGAAGCTATCATTATGGAACCGAAGTTTAAGGAAACACACTAACTGATTCGAAAAATCTATTTTTCTGTATTCTTACT AATGTAAAATATCTGGTGTTCTGCCATATAGATAGCNATATTTAATTATTGATAAAGATTATTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1235460: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12354602369555AA585002SWMFCA2829SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:13:53 on Thu 23 Nov 117.