EST 1235473 is a singleton


Sequence

>1235473 (1 EST) Length=448 TCACAACTATTGCTGGGCGTGCGCGTGGGGATCATTTTGGCGTTTATCAACGTTTCCAGTTGCCTATGGATGTTGTTGGT GACTTGTACCGGTTGTTACTGGTTAAAATCAATACCGTAGTTCCTGATTTTAACGGCAGACTGGGCTGGAAAGACGAAGA AGTGATATAATACATTTTTCAACTGACGAAGATTGCCATGCCTCTATTACCAGGCACACTCTTCCACGACAAGACCCCAC TAGAAAAACTCAGGACCANAAANATAGAATAAAACACCTTTCTTACTCACGCCTTGATCTATAATCGTATGTATACCATT TTAAATGTAAAATGGTCACCAACTCTGATCTTCCCCAAACAAGTGACCCCTCCAACCACTGCACAAATCTCTTGCTCCAN CATTCCAGAAGTTTCGAGACGCACGCGCGCCATCGCCTATCACATGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1235473: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12354732369568AA585015SWMFCA2846SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 13:43:36 on Fri 24 Nov 117.