EST 1235476 is a singleton


Sequence

>1235476 (1 EST) Length=594 CAAAGTTTGAGGGAATATAAAAAGAAACTCAAGGAAAAAGAAAAAATGCAAAGAGAAAGAAAAATAGATGTTACCCCGAG TAATTATTCAGTGCTGGATACTGAGTTTGGAAGTATGCGGGAACGTTTCGAGACCGAAATGAGGCATGTTGAGGAAGAAT GAACGTCTAAGGCGAGAATTTGAAGATATACGCCATCACAGCCAGGATCACAAGCGGACAATCGCTCCACACTACACGTG AAGATCCAGACTTACGATCACCCACACAGGCACGGCCTCCCCACAGCATACTCCTATGAGGAGTTTGGACACGGATANAT TCATCGACACTCACCTACTGAAACTAATCACCTACAAATAATATGAAACCCGACTAATCATTGCCGTACAACAAAAGTAC ATAAACGTGATACGACTTTGGTCNTGCTAACANAAAAAACACGCACTGCGTATCGANATATATCNGATTATGCTCCCGTG GACAATCNGACTGATACATCCTAATTCGATGGGTTTACGGTGAGNNCCTNCCCCCTGNTTTCCCNCGATTGCTTTCCCTC NNTCTTATNTTGGTATCCATATGATANCCCTCNC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1235476: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12354762369571AA585018SWMFCA2852SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 7:10:34 on Mon 20 Nov 117.