EST 1235484 is a singleton


Sequence

>1235484 (1 EST) Length=526 AAAGCAGCTAAAGGCGAGTAATTCTCTGACTCTTCGGGGATTTTTATTCCGAAAGTTTTGTTTGAAGTTTTACTTGAACA AGAATTGCAGGGTTTCGGTCCTGTTAAATCCAAAGCCACTAAAGGGGCGGGCTAACGGGCCGGCCCCTTTAAATCCAAAT GGCAAGCAAACAGCAGCCGCTTAATTTGCCTTTAAGGGAACCGGAGGAATCATGACCAAGTCAGAATTGATAGAAAGACT TGCCACCCAGCAATCGCACATTCCGCCAAGACGTTGAAGATGCAGTAAAGAGATGCTGGACATATGGCCTCGACTCTTGC GCAGCACTTGAATCGCGTTCGATTCCTGCATACGCGCACACTCGACTATCAAGAATATGAGAATCTCCTACGTAAGCACC ATAGTATTACATACAAACCTGTCTTCTCCACGATGACGCCATGACTTCACCTATCTCATTCCGACATCCAACTCCATCCT CTACGAGTCTACATCATCGTCATACGATTCTGATGCATCGATATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1235484: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12354842369579AA585026SWMFCA2866SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:27:24 on Sun 19 Nov 117.