EST 1235495 is a singleton


Sequence

>1235495 (1 EST) Length=508 ACAAAGTGTTAGTGGCCGGTGGTGAAANGTGATTTTCCAAAGAAGCAGTACAAAGGGAAAGAAAAATTCAAATGTACGCG GTATAACGCTTGAAGTTGGTGATAAGCCTGATCTTTATCATTTGTTAACTTTTGATGAACAAACGATAAATGCTTGGTGT GATGGTATCAATGCTCTGATTGGTGTCAATAAACTGTCAATTCAAGCTCAACGACAAGTGGATCGCTTTTTAAATATTGA ACTAAAAATGCGATTGCTTGAACTGGATCATATCCAAATTCAATCGAAATACCACCTCTACCAAAAAATTTGATTGGATC CAAAGATATGCTGACACTAAGATTCTGTACAAAATATACTTTTCAACTGGAAAATTGATGTTTGCATAAAGTCTTATGTA TATTGCATTTTAAATATATTTCGTGCTAAAGCTGTATAGATTATGTCATTGTTCAAGTTGATATAATTAGTCTATGTCAT CTGCCATTTTATAATAAATATTCATCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1235495: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12354952369590AA585037SWMFCA2881SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:34:30 on Fri 24 Nov 117.