EST 1235507 is a singleton


Sequence

>1235507 (1 EST) Length=549 CCATTCTTAGGATGTCCTCTATTTAACCTTGTCAGTCCAGAGTGTGGACACTACTAAATAGAGATGGGACAGCAGGGCTG ATTTTAAACACTCACTTGCCCACCAAGCCCACCTACAGTGTCTTGGGGTATCTATTTAGGACATTAAAGTGATCTCATCA TAATTACTCTCAGTGGAGACTCAGCTGGCTTCAGGATCTCTGGGACAAAGGGATCTGTGTAAGTACTGGCAACAGACAGG TGGGCAGTGGGANTCCCATATGAAGCTATTGCCTCTGTCCAAGGTCCAAGAATTCAAGAAAAAAACATCTCTCTTCTCTG AACAATTGGGTTGCCCCTTTTCCTGCCTCCACAAGATGAAGGCACCCANTGCCTTCCACCCCCACTACTCTCCTNGGTCC CTGGGGTNCTTCCCCCCTGCTCCCCCTGGNTGTTTGGCCCCAATTGCCCAACCCTGGCCCCAAGGAAANCCAAACNCCCA AAGGCCACAAAACTNGGGCAACAAGGGCANCTTTGAAAACCCNTTGGAAAATTCCAATTCTTGAAAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1235507: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12355072369602AA585049SWMFCA2905SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:31:36 on Fri 24 Nov 117.