EST 1235509 is a singleton


Sequence

>1235509 (1 EST) Length=868 TCAAAGTGGGACTTCTTCGCCACTTAATGTCGACACCGATGACATTATCACGTATATGCACTTACCTGGTTCACAACAAA ATGTCGTTCCGATCTATTTTCACCAACTTACTCTTTCCTCAGACGGTACATCCGGTCAACATGGAAATGCTGAACTGATC AACATGGACAATAAGCACTTCTCGGATAACTTGAATGTCCCCAAGTACAGGGGAAATACCAATGAAGGATCAGAAACAAA TGCTCAAAGTGGGACTTCTTCGCCACTTAATGTCGACACCAATGACATTATTACATATATGCACTTACCTGGTTCACAAC AAAATGTCGTTCCGATCTATTTTCACCAACTTACTCTTTCCTCGGACGATACATTCAGTCAACATGGAAATACTAAAGAG AGCAACATCGATAACAAACAATTCCTGAATAGCTTGAGTATCCACGACTTCAGGGGAAGTACCAATGAAGGATCAGAAAC AGACGAACGAAGCTACGAATGTGTCTATCGAAGATGTTCTATGGTTACNAAAGATTACNATGAATATATNGCACATAGAA AAGCCCATNGGTCNANCCTTCATCTATGAATGTTAAAATGCCGGGTTGTGACCATCATTCCCCCATGAANCACATTTTAC AATCCCCAAGCCAACGCNTGAATCTCATCGTCAGTGCAACGCCGTGGCAAATCCTCCACACCNGGAATGGNTTCNAAAAC CCANGAACCCTGCCCACAAATTTCNTNNAACAAGTTTGAATGCCTTATCCCGGAAGNTGCGTGATCNCAAAAATTCNACG AATTCTACCCTTNAAAAAANCCTCCNCCCTCTCTATAAATGCAAATGCCCTTGNGGGGAAATANAAAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1235509: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12355092369604AA585051SWMFCA2908SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 8:50:14 on Mon 20 Nov 117.