EST 1261701 is a singleton


Sequence

>1261701 (1 EST) Length=500 CAAGTTTGAGTACCTACGTTATGGCTGGAGGTAAAGGCAAAGCAGGCAAGGATTCTGGCAAATCTAAGGGTAAAGTCATA TCGCGAAGTGCACGTTCTGGCTTGCAGTTCCCTGTTGGACGTATTCATCGCTTCCTAAAACAGAGAACCACATCACACGG ACGTGTTGGTGCTACAGCAGCTGTTTACAGTGCAGCAATCCTGGAATATCTAACTGCTGAAGTACTGGAACTGGCAGGCA ATGCTTCCAAAGATTTGAAAGTGAAAAGGATCACACCGAGGCACTTGCATCTGGCAATACGAGGCGATGAGGAACTAGAC ACACTGATAAAAGCCACTATTGCTGGTTGGAAGTTTTGATTCCCGCCATATTCCATCCGTTACCTAAATGAACCAAGAAA AGACAGCCCGACTCCCAGCTCCANAAAACAGGGTTCCCANCCCTTGAACCTTAACCATCCTCCTTTATGCCATTTTNGGC TAATTTAATGGTTTTTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1261701: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12617012392897AA585485SW3D9CA017SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 17:2:17 on Wed 22 Nov 117.