EST 1261715 is a singleton


Sequence

>1261715 (1 EST) Length=349 AAGAAACAACAGAGCAAATGCTTTCCCTTCTTTTCAATCCTTACCCTGGTCTGAAAGACATCAGACGTATACCGAATAGG CCAGATATTGCATTTGTTGAATTTGAGACGGAAGCCGAAGCAACGTCAGCTCGTTCTGGTTTGAACAACTTTAAGATAAC GCCTTCGCAATCGATGTATGTCAATTATGCGAACAAGTGATTTTCCTAGTTGCTTCTTTTGTTTTGTTGATCTCTGGGGT ATCTATGTTATTCTCTTGTGCGGTTGCTTTCATTTATCATAATGTTGTCGTTCAAATATGTTCAGTTTTCCTTGTTTTTA TCTACGTTAGTTTAAATTTTAATTTCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1261715: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12617152392911AA585499SW3D9CA042SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 22:29:34 on Tue 21 Nov 117.