EST 1261721 is a singleton


Sequence

>1261721 (1 EST) Length=321 TAGGGGTCGATGTCAGTGTAAGTGTGGCTTTAAACAAGAGAAACAACGATGTGTTGAGTTACCTCCATCACCAACGACAA CAAGACAACCATCCGTGATAGTACCTGGTACTGTAATCGTACCTGGTGGCGATTTCTTAAGCCTCATTGGGAACTTTTTT GGTAGAACGGGAGCGCGAAATGCTATCGGCAGATAACGTAGGATGATTACACAATATACATTCCCTGCTTTACATTAACG CTGTATTATGCTTTGTAAATTATTGTAGCAAAAATCTCTAAAACATCCCCAAAAAATTGTTTGTAATTAACCTTCNNNAA A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1261721: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12617212392917AA585505SW3D9CA052SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 12:20:34 on Fri 17 Nov 117.