EST 1261734 is a singleton


Sequence

>1261734 (1 EST) Length=370 ACGCTCCAATCAGCGTAAAGCAACGACCANTCGGGCCATCCACGCCTTGTAAATAGTTAAGATCGGTACGGCTGGAAATG TTACANAGGTAACGATAGGCATAACTGCCAGTTTCAATATTGCTGCACATGACGCCCATCAGCACCGAACGGTCGTCCGC GAGCACCGACTAGTAGTGCATGGTGTTACCAATGGTGCCACCCACAAACTGATGGGTAATCNGGTTTTTCTGTGNTCGTT CCTGCCACGGCGGGTACGCTCCGTCAGTCCATCGAGAATCGCTAACGCCTTGATCAACCAATAAACCCCGTAAANTGTCC GGCGTTTCNTGAGGAATGCCGAAATTTATGCTCNCCGACCNCCGCCCCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1261734: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12617342392930AA585518SW3D9CA072SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 7:34:14 on Sun 19 Nov 117.