EST 1261738 is a singleton


Sequence

>1261738 (1 EST) Length=379 ACGCAGAATTGCAGCATTGATTGCTGAACACGATCTGGTGCTCGACTGTACGGATAACGTTGCGGTACGTAATCAACTGA ACGCAGGCTGTTTTGCCGCGAAGGTACCGCTGGTTTCCGGCGCGGCAATTCGTATGGAAGGTCAAATCACCGTCTTTACT TATCAGGACGGTGAACCGTGCTATCGCTGCCTTAGCCGTTTGTTTGGTGAAAATGCATTAACCTGCGTGGAAGCAGGCGT AATGGCACCGTTGATCGGCGTAATTGGTTCGTTGCAGGCAATGGAAGCGATCAAAATGCTGGCAGGTTATGGCAAACCGG CCAGCGGGAAAATCGTCATGTTACAATGCNATAACCTNTCANTTCCNCAAAAATAAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1261738: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12617382392934AA585522SW3D9CA078SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 12:45:28 on Fri 17 Nov 117.