EST 1261797 is a singleton


Sequence

>1261797 (1 EST) Length=731 GAAATGTGAACTTCTGAAATTAGAGGNCGNAGNNAAATAAGCGTAATCATAGTCTTCCAATTGCTCCTGAATCTACAGTG ATCCATCGACAAAAAGAGAAGAAAATCGCTACAAAAACCGAGGAAGCAGCCATTGATATTTCTCTGGATCCAAGACATTT TCTTCAAGTCGAAACGATGGCATTGCCACAAGTGTCAGCTGACTTCGTTGAAACTTTGGAAGATACTTATGAGCAAGCAA AGGATCAGGAAGAAATTATAGCCAAGGCATTCGAAGATGTTGATGTTATTGGTGATTTTGAAGCGGAAAAGGAACTGTGG AAGCAGCAGAGAACCCAAAAGACATCGATCTAACTCTTCATGGATGGGGTTCATGGACGGGACCGGGAATAACCGATAAG AAAAAAGATAGATTTGTAGTCCAAGTTGCCGANAAAGAAGAAGAAAGATGCCTGGAAAAACAGGCTTAATTATATCCAGA AACAGTGGATCCNTCCATTGAAAAGATACACTCCAATCGGTNCCATTTCCTTATACAACCGTTGAAGATTATGAAGCCGT TNTACNACNGCCATTAGGAAAGGATGGATCCCCCACNANTCCTNTGAACTTATCCGCCCCGATTGTTACAAAGCNGGTTG AATATCCANCCCTGGATAGATTTTTTGGAAGATAATCTGATGATGAAAATAATTTTTGTTNTATTATTAATCCNCAATAA TCNCTTATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1261797: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12617972392993AA585581SW3D9CA243SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 20:12:11 on Sat 18 Nov 117.