EST 1261798 is a singleton


Sequence

>1261798 (1 EST) Length=246 GTTTGAGATCGTATTGGACNAATATAGGCACNCCGGAATGATGCGATTTAATATGGATTATATAACTGCTATTGATNGTA CCAGTAATGATGGCTCNCTTAGACNTCTCGATGAANANTGACCGNTCTATCNGTACTGATGTCCCTGTCAACAGCTTNCT GAGAAGTCGTCAAATTATACGACTAGAGCTACCAGGTCTCCNATGTCCTAATGTCCAATATCTTATGGATTTTTATTGTG CNCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1261798: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12617982392994AA585582SW3D9CA247SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 2:24:44 on Mon 20 Nov 117.