EST 1261800 is a singleton


Sequence

>1261800 (1 EST) Length=516 TGATGGTAACATTTTCGATCGTTACTTTCTCGCTCATATGGATTGCATTTTCTGTACATGCAGATTTCCAGAAAATTAAA TTCAAAAATTGTAAATCAGTATTCAATATTACAAATGTAGAAGTAAATGGATGTGTGGGCTCATCGCAGCGCCATTGTGC TTTCAGAAGAGGGACAACACCGCATTTACGAATTGAATTCGTTCCAACACGAACAACAGAAACTCTTGAAACTGCAGTAC GGGCAAAAATCGCCGGTGGCGTTATTGTATCATTCAATTTGGAAGAAAAAAATCCGTGCAGAGGTGGTAACCTGACGTGT CCTCTTGAGGAAGGCAAGACGTACTACTATCAGCAAGGTGTCAGTATACTCAAAGAATATCCTATGGTGGATAATGTACA AATTAATTGGCTTCTCAATGATAAAAGCAACGACGGACTCTAAATGATGCTAACAAACGAGAAATATGTATCATATTTTT AGCGAAAATTATTGAATAAATATAACAGTATGCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1261800: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12618002392996AA585584SW3D9CA254SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 14:26:1 on Fri 17 Nov 117.