EST 1261809 is a singleton


Sequence

>1261809 (1 EST) Length=606 ATAACTTCTCTCACTATGTCAACCGGTATACCATGCCGAATAGTGAACACAACCTTTTTTATAGTTTTGATCTTGGTACT GCTCATTTTATTGCCATATCAACCGAATTTTATTATTTCACTGAATATGGCTCTATACAAATAGCGAATCAGTGGAAATG GCTTACTGAAGATTTAAAGCGCGCATCTGCAAACCGTGACAAATATCCATGGATTATAACAATGGGACATCGACCGATGT ATTGCTCGAATTACGATTCCGATGATTGCACTAAATACGAATCGCGAGTACGTTCGGGCGTGCCTGGAACACATCGTTAC GGTTTTGAAAAATTGTTTTATACATATGGAGTTGACTTAGAAATTTGGGCGCACGAACATTCCTATGAACGCATGTGGCC ATTATACAATCGTACCGTTTATAATGGTACCAAGGAACCATATACCGATCCTCCAGCACCTGTACATATCATTTCAGGAT CTGCTGGATGCCAAGAATATACCGATCCATTTGTTACCCCAGCCATCTCCGTGGGAGTGCATTTCGTTCCTCAAACTATG GCTTTGGTCGACTTCATATATTTAATGCAACCCATCTCTACTTCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1261809: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12618092393005AA585593SW3D9CA273SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 9:14:7 on Sat 18 Nov 117.