EST 1261826 is a singleton


Sequence

>1261826 (1 EST) Length=514 GAAGGCCAGGACCACCAGGAAGCAAATGGAAAACCAGGCACACCAGGAAGCACCAGGACGGCCTGGTGCACCTGGGCGGC CACCGATAGTTTGCGAANAGGTTGATATTCCGCCATGCAATCCCTGCCCACCAGGAAATAGTGGCAATGCTGGTCCACCA GGACCCGTGGGACCACCAGGAGCACCAGGTCAGCCAGGAGCTGACGGCGAAAGAGGTGAACCAGGAAGACCAGCATCAAG TACACCTGTACTTCCAGGCGATCCGGGTCAACCGGGTGAACCAGGACCCCCAGGCTTACCTGGGCCAGATGGAAATCCAG GCCGTGATGGACAACCAGGAAGTCCCGGACCAAATGGACCACCANGACCACCGGGACCACCTGGAAATCCTGGTGCTAAT GGTGAAATTGGTGCACCCGGTCAACCANGTCCACAGGGTGAACGAAGTATTTGTCCNAAATATTGTGCATTGGACGGANG TATATTCTTCNAANATGGAACACNAAGATAATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1261826: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12618262393022AA585610SW3D9CA322SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 14:6:28 on Fri 17 Nov 117.