EST 1261828 is a singleton


Sequence

>1261828 (1 EST) Length=340 GTTTGAGATCACTTTGTAAAATATGGCCTCAAAGGTAATTAAATCGGCACGTGAACGTGCTTTGCGTTATGTGGAAAATG CAAGCCGTTTGCAAAGACAAGATCTTCGAGATAATCCTGGTGCTAGAACTCAGCGTCGTCAAATAAAGTCTTCCTTGCAC AATCAAGCTGGGCATACAATCGGTGAAGCTTCAGCATGCTGCGAAACCTCCACTTGGATGGATTTGGGGTAATTTCTATC AACCATGGCAACGTCTTTTTCCAGGCGAANAACATTTNAACGGTGATATTAACTTAAGGCGAAAATATCCACCATTATCG TTGGGGTNAATTACCCCACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1261828: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12618282393024AA585612SW3D9CA324SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 11:53:43 on Thu 23 Nov 117.