EST 1261844 is a singleton


Sequence

>1261844 (1 EST) Length=359 CCGCCACCACCACCACCACCCGCACCTTACGTCTATCCACGAAGGCCTATAGGAGTCGGCTATGGTTTTGGCCTGCTTCG AAGGCATCGCAGTGCAAGATCGATAGTCTTTAAGAGACGACAGTTGTGATAATAGTAATCTTAATATTTTCCACAACCGG TCAGTATTGGAGCCTAGGAAAATGTCTGAGTGATATTTTCTTCTTATATTCTCTATCTGAATTAGAGTGAAATTCTTAAA ACATGATGTTATCCTATACATGGAATCTTGTACTCATATTTATCAAAAGAGTTAACACTACTATATCAGAAAAATATTTT GATTCATTGTAATATTGTAGAATAAAATAACATATCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1261844: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12618442393040AA585628SW3D9CA353SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 22:30:52 on Tue 21 Nov 117.