EST 1261860 is a singleton


Sequence

>1261860 (1 EST) Length=446 CGATTATGCAATTTGGGTTGCGCTACAGGTCATCCATCATTTGTTATGAGCACGTCGTTTACAAATCAGGTGTTGGCACA AATTGAATTATTTACAAAACATGGAACTCCGCACCAATACAGCATCGGCGTCCATGTGTTGCCAAAAATATTGGATGAAG AAGTTGCACGGCTCCATCTAAAAAAACTTGGCGTANAACTAACAAAATTAACACCAGAGCAAGCTGAATATCTTGGCATA CCTATCGAAGGACCATACAAACCAGACCATTACCGTTACTGATTGAATGTACGACTATTCCTTGTTCCCGTTGCTTCATT GTTTTGACTAAAATTGTTGATAACTCATTTCCTTGTTTACAGACTGTTACGTTTTAAGTCAATGTAATACAGTATGTCCC GTTTTACATGCCACATTTCAGTAAAATAAATACTTGTTTTTATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1261860: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12618602393056AA585644SW3D9CA385SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 13:36:51 on Fri 24 Nov 117.