EST 1261864 is a singleton


Sequence

>1261864 (1 EST) Length=442 GAATATTTCACTTTCACAATGGTTACAACAAGGNAATAGAAAACGGACAGAGGAAAGTAACGAAAATAAGAGTGAACGCA GTGAAAACCATCGAAATGGTGGACAAAATGTTGAAACTGTCNAAGAAATGATGCCTGGTGTTTCTACAAGTAATGAGGAT GGCGAATTAGTGGAAAATGAGAGTGGAAATGAGAAGAGTGAAATAGCAACTAAAGCAGATAAATTATCCAGTGAATCTTC AAGAAAAAGTCGACAGGAAGAATCTAGTAGTAATGTTAGGGATAGAAAACGTAAGAGATCACGATCAGCAGATTCTGGCA GTGATATCAGTCGAGATGATTCGAGAACACGGTCGAAACGCAAGCATTCAAGTTCATAAAGATGCTAAGTTCATCAAAAA AGCACTCTAAAATTGACAGACGTCGTCGTTCTTCGATGGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1261864: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12618642393060AA585648SW3D9CA391SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 2:44:34 on Mon 20 Nov 117.