EST 1261888 is a singleton


Sequence

>1261888 (1 EST) Length=850 CTGACTTGGACAACAAGGCTTGGGATCGTAACGGTCCGTTGCGTGATTGCTCCATTTGTCGAACGTTCGCTAATGGAGCA ATTAAAGCAATGTTATCGACCTCTGCCGAAGAGCAGAAATGTATACGTTCTGAGGTTTCTAGAGCTGTAACGATGGAAGT AGAGTACTGTTTACGGGGGAAGATTAACAATTTTGGTGGCATTCCTGAGTTTCCAGATTTAGAAGAAGGTTCATATGCAT TTAAGGATGAAATAATTAACTCGATCTCAGATCATATTCTAATCTATAGCCGTCTAGCATTCTGTAATGAACGTAAACCG GAACGTGCAGAAACTACAAGACGATGCTTGAAGAATCCGTTTGATGGATATCTTGCAAAACATTGCAACATTCTAAAGGA CTGCAGAAGTCAAGTCTCAGAAGCTTGTCAAGCACAAACTATGCAACTAATGAAAGCAACTTGTGAATGTATTGAGAATA CTCGATCAGAACTCAAAAAGCGTCTTGCTTCTATTGCACAGGCTATCAGAAATGTCNTTGATAGCAACGATCGTGGTGCA GCATCCATCGGAAGTGGTAGCAAGGTGGATCAATGTNTTTCCAGCNTCCAAAGCNTTTATTGAAGGACNCCAGTGAATGA ATGGGATTGAAGGTTNTCNACAAANCNCCTGGGAAAAATGCTTGAAAGAAAAAAACCCACCGGGGGCAAAATCTGGGGTC CCNAAATCCCCTTATCAATTTTCNGGGTGGCCNAAANGGTTTTTGCNGAACCTANCGGGAACCGCCCCCCTNCCGTTGAA AAATAGGATTCGACNTTTTTNACCATTTNATGGATGCANNGGTTAAACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1261888: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12618882393084AA585672SW3D9CA428SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 4:11:14 on Thu 23 Nov 117.