EST 1261897 is a singleton


Sequence

>1261897 (1 EST) Length=468 GACAGACNTCTCACTTGACNGTCGGTGANATAGCCGCAGATGTTANGGTNCNACCGCAGATGGGTTTTCGACAGTTTTAA TAGACGAAGTTGCCTTTCAATAAAGAAGTATCTTCCCGGTGCAATACTGCCACCTCACTTGTCACCTTTTTCCAGTGATT ATGACACTTATGAAGAGCAGCTCAACCAGTTGAGGCTATTAANCAAAGCATCGGCAAACGTGACCAACAGAATGGAAACT GAGGCAGAANACNAAGTGCNAGAAAGGAAAAAAATTCANAAAGAAAAGGAAGTACCAATTATAAACGTCNACAAAGGTCG AATGCATAAAGAAAAATTTGCAGAAGAAACTAAACGAAAAGGGACNTGAACTCAAACTACGTGAAATGCTCNTACCGAAA AAGCGTANACGAGTGTATCCNAAATCAAGCGANGAATTAAACGTCGAGTTCCCNAAGAGAAGAAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1261897: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12618972393093AA585681SW3D9CA444SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 10:3:27 on Wed 22 Nov 117.