EST 1265200 is a singleton


Sequence

>1265200 (1 EST) Length=440 GGGGGNACACCTACTCCACCGCGGTGCCGGCTGCTCTAGAAGCGGTTTAATTAGCCCCAGTTTGAGGTAAAAATTTAATG AACAATTGAATTGTGCTTGCAACAATTTTTTAACCTTCAAGGAATGCATTCACAAATAACAAGCTTGCGTCGGAACTCGT TCCCAATTAATTTAGTAAATGGATTGGATTTGGGATTTCAAAGGAACGGCAATTAGTAAGGAAAGAAGGAAAAATCCACC TGGCTGGTGCACATCCTCACCTGAAGGTAAAAATAGTAATGAAGGTACCAAAAAATTTGTTGAACGGGGTATCTATTTTG TGCTCAACCANCGGCTANAAAAAATGANTTNTNATAAGGATTTGGCTNCCTTCNATTCTTNCTGCNAATCATTTATAAAA AAATTANTTNAACTNATGCAAAAAAAAAAAAAAAAAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1265200: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12652002402571AA588908KJ4SLB259T3JHU93SL-BmL4 (JHU)


Date: 3:7:14 on Tue 21 Nov 117.