EST 1277421 is a singleton


Sequence

>1277421 (1 EST) Length=684 GAACAGGAATGATTTACGATATTTGATATATCTGCTCGGATACAAAGATAGCTACGTAAAAAAAAAAGCTGTTAANAAAC ATCTGATACGATTACACAAAAAGATAAGGAATATTTGTATGCTTCTATTTTGATATTTCATTTTGTTACTGAATTCTATC ATACTGCTAAGGAATATGGTCATTGCTGTATGGTTTTTTTCATTCCTGTNTTTAATTACAGTTTTATCTGACAGTCTCAA TGGAACAGGAAAATCANAACTAGGATCTTTGGTGCTGGATAGCGAAATTGCGAGCATGGTGAATAAATTTCGGGAACAAN ATGTCNATAAAATTGATAATGGAAAAGTAATTCTGGATTATCAGGGACATACGGTAACTCATGATCCTACTGATAACGCC CTAAGAAGGTTATTTAAATGGATAGATCCAGTCTCCCTGAAAAAANATACATACCGAAAGTGGATTGCTCTGANTAATGA ATACCATTCNNAAATTGGNGTTTAAGAAAATCCTTTAACGAAAAATAAANCTNTGGATGATTTCCTTGANACGGGCTTTA ATACCNCTGTNTTGGAAANTCTTTATCAATTCTGCCCNAAANGTCCTCCTTTTCCAAAAATCGCTACNTCCCAACTAAAN TAAACATTNTGGTTTCGGATNTCCCAATTAAGGTTCGTCCCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1277421: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12774212429563AA598370SWMFCA2932SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 13:33:34 on Fri 24 Nov 117.