EST 1277426 is a singleton


Sequence

>1277426 (1 EST) Length=749 GGATGATAAGTTACCTGAGGATTTTGATGTGATTATTTTGGGCACTGGACTTCCGGAATGTATGATTGCGGCGGCTTGCG CCCGTTCTGGTCTTAGTGTATTGCAGTTGGATAGGAACGATTATTACGGTGATTTGTGGTCCTCATTCAATTTACGAACA ATCCAGAATTGGATAACGAGAGATAACAAGAATAATAATGAAGCTGAAATTAATTCTGAATCTTTTCTGCGTGATGGTGA AGAATTTTTACCAGTTACATATCGTTCTTTTGTTAAGAATGTCCATCAACATTTTTTCCACGACAATATTTCAAATGTTG AGGGATTGGATGCTGCTGGAATAGCTTCACATGTGCAGGATATCAATCCTCAATGGCGAAAATTTAGTTTGGATCTTTTA CCTAAGGTNTTATTAAGTAGAAGTGATATGGTAAAATTGCTGTGTGATTCTGGTGTTGCCAAATATTGCGAATTCCAGTG TGTTGATCGACTTTTGAGCCATATATCAAATAAAGGCCAAATCGACTTGAAATTGTCCCTGTTCCCNAAGCGAAATATCC GAANTGATGCTATTCCGTGCCAGATAAACACAATGATGANATTCTCCGAAATGCCTTGAATGGAAGAAAAATCCCATGAA AATGAAAGGTNGGAAAGAATTTGNCGAAAAANCGTTTGAAACTTTCGTGGAAACTAATGGTATCGTAGGGTCCANCCAAA AATNTACTTACTGAAACTCTNACAANCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1277426: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12774262429568AA598375SWMFCA2937SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:12:1 on Fri 17 Nov 117.