EST 1277442 is a singleton


Sequence

>1277442 (1 EST) Length=861 GAGTAATCCAAATCATCATGATCTCTGTTTACAGGTAGCAAATGAGCTGATAAATCGAAACAGTGAATTTCCGGTTGAAA TTGTGCGAGAAGGTGATGAGCCGGAGAAATTTTGGGAGTGCTTAGGGGGTAAAAAAAAATATGATACTAATGGTGATTTC TTAAATTTCACAAGGCTATTCCGTTGTACAAACGAAAAAGGATATTTTGTGGTCTCCGANAAAACTGTTGACTTCTGTCA GGATGATTTGGATGATGTTGATATCATGATTTTGGACAATGGANATTTGGTTTTCTTATGGATGGGATATCATGCTAGCG AAGTNGAGCTTAAATTAGCATATAAAGCTGCTCAGGTTTATGTTGCACATATGAAAATCAAAGAACCTGAAAGGCCGCGA AAGTTGGTGTTAAGCTTGAAGGGTCNAAGAATCACGACNATTCNCNAAATGCTTTCATGCCTGGGGGAAACATAAAATTC CAGCTGGGGATGAAATTTAACTTCCAGGACTTTGACTGTTGTGGTCAGATTATTAANTTTTATANTTGGTCTCCNTGAAT AAATNGGTCTTTTTTTTCCCTCCCTTACTCNNTCCAAAANTATCCTTTTTATTTGAATTCCTGTNCTACACTAAATNTGC AAATGCGTTAATGCGTTATGTTTTTTCCTGAACATATNTNCCCCTNTTCCGGAACCTNTGACNGGAAAATTTTGCTTTAA NTTCCANGGTCATTCCNCTTAGGTGGCATAATATAAACNGTGTTATGAAANTGANATNTGAAACGTTNAGGAATTAATNA NGGTTTNNGGTTTGGTTTTTTTTTAANCCAAAATNNCCTAAAAATATTTTTGCCATNAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1277442: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12774422429584AA598391SWMFCA2961SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 6:44:31 on Sat 25 Nov 117.