EST 1277456 is a singleton


Sequence

>1277456 (1 EST) Length=787 GTCTTTACATCTTTTTTACAAATGTTGAATTTGCTTTGTTAAGAAATNCCACTTTTCNGTGAAGTGGTNGGCAAAAAGTG ATNAGAGTTCAGTAACCGAATCTGCATCTCCTATTGATGCAGATTTGTTGCGTGGGATTAACTGGAAAGTACTTGCACTT GGCCTTTGGCTTTTTCGATTTTGTNTTTTCTGGTTGTNANTGATCAAAGAAAAAAAAGGGTATACCGGTATGTTCTTTNN AATTAAAAGTAAAAATACNGTGTATTTNGGTACATTTAAANTTTCNGATTTTGCAGCTTTGGANTTGTTGTGTAGGGANG ATCGCTAGCATTACTGAAAAAAATATNCGGAGTTCAGCCATAAATGTTCTGTTCACTTTAGGAGTGAATGTCGGGGTAGA GTAAAATTTTTTACCTGCAAATATTTTCACTAAAANGTATTATTGTTTTTTAAGGAACTAATTTTANGGTATGCTGGGTA CCCCTATGAAATGGACGTGCGAATTAACCAAACAGTCTCCAAGATTGGTCCCTTTTCACCAGTAAGAAATCGTTTTGGGA TTAAACNGAAGAAAAAANTTCGGCGACCCATTGAAGAATTTTAAAGANAAAATNGAACNGCNAAAGAAAAAATTACCTTA TCNGGAAAAATTNAATCCCCCTCCCTCCGTTGAAAAAATTATNGGAAAGCATNCNGGTTTACCAATGGGGGTTGAACTGT GTCATTGCCTTTGGCTACNAAATNTTATCTTAAAAAAACAACCAATANGTGGCGTGAAATTTANNAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1277456: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12774562429598AA598346SWMFCA2985SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:2:4 on Sat 18 Nov 117.