EST 1277461 is a singleton


Sequence

>1277461 (1 EST) Length=888 GTTATATTATATCTGATGATCGTGGTATTTCTGTGGTGACGCCTGCTGAATCTTGCATACTGCAGGAAGTGCCTTTTCAG AATCCTAAAACAACAGTGCCAGCACACTCCCGTGTGTCGCCATCATCTCGAGACTTCAGAATGCCGCGAATTCCGTCTCA GCAAGTACTTACTCCTGAAGATCGTGCAGCAAGTTGGACCTCACGTCATTCTTCGGCCAGTTCTGGGTCGAGATCTTCAC AAAGTAATAGAAGTTCACTTCACTCTAGTGTACATTCTGAGTCACGTGGATCAGTTGCAAGTGCATCATCGAAGTTTACT GCTCCGGGACATTCCTATCAAGTACCTGTATACAACAAACCAAGCGCAGTAAGGTTGCATAACAAGAAAGAGCAGCAGAA ATATTCTATGGCTGCCAAATCTCAACATANTCCTTACGTTGTTGAAGATTCTGCTACAGCGAGTANGTTCCGAGACGAAA GCTCATTTCGGACTGCAACCCCGCACTCCAGTTACTCTGAATATTCTATTGCGTCGCGTGATGTGCTTGTTCAGGGNTCA TTTATTGACGANGCAGTCAATCCACAGCTTCATTTTCAGCAAGCANAACTGGNGCNGAATTTGTNGCACCGCNGAATCCA CCCTTACNACAACNGGAGCATCCNCNAGAAAAANANTTTATAANGGGTTCTAATGTTGCCTGTNAACCCAGGTTTGGGAN TTGAATGCAAATAATGGCGTTCNAAGTTATCGCNGCCCTAAAAATTTTCATCCCAAATGTTTGGCGGTNAAACGGGGGAA TTANTATTACCAATGGGCGTCTGTTTTGAAAAAAGAAGGAATCCTNATTTAAATTAAAAATTTGGTTCCCAATACTCCCG GAAGTTTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1277461: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12774612429603AA598351SWMFCA2992SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:4:38 on Fri 24 Nov 117.