EST 1324723 is a singleton


Sequence

>1324723 (1 EST) Length=418 ATTAGATGAGCCATTCAAATTTACTCAGACGCCTCCAGATATTCCAGTTCTAGAGGCTCATTCAACAGATCTAAGAAGAC CAGGTGGTTTTGTGGAGCAAATCGAACGACAAGTAATGCAGGTAATAACCAAAACATCACCATCATCAGATATTGAGAAG TCGAAGAAAGAAAAGAAGACAAGTGCATCGCCGCGTGAAAGCGAAAATTTTAATGCATCTGAAATTGAAATTGTTTCACA TGATTCTCATGCGGACAAATCTGATTTCACTGGTGAATTACTACCTGAAGAAGCAAAACTAGACGATCGACTGGTGGAGT CGGATGTGGACGTTGTACCAGCCATTCATCCGACTAATATTGATGTTTCGCTTCCTTATACATGCGTTGAAATGTGGCAA GAAACAATAAATGAACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1324723: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13247232539366AA626979MBAFCW2B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 3:1:24 on Tue 21 Nov 117.