EST 1324725 is a singleton


Sequence

>1324725 (1 EST) Length=422 GTTTGAGGGATGCTTTCGTTGAGAACATGTTTGAGGCGATTTATTTTGATAAATAGAGCGTCGTTGTCGTCTAGTGCTGT AACGACAGGTGACTATATGGTGGAGGATGACGATGGAGTAGTGCAGATGCGAAAAGATCCGTACTGTAAACCAGTAAAAC AGTGTTTTTTATGTGCAAAGAAAATTGAGTTAGATTACAAAAATGCTCGCTTATTGCAGCAGTTCGTCTCAACATTTTCT GGAAGAGTTTATGATCAACACATCACTGGACTTTGTAATGGACAACAGAGAAGGTTATTGGAAACAATTGCATTGAGTCG TCGTGCTGGTTACATGCCAGTATTCGTTAAGGATCCAAAGTATCTGAGAGATCCCAAGTTGTTTGATCCACTGAAACCTA TCACGCCTCATAGTTATGCATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1324725: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13247252539368AA626981MBAFCW2B06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:21:57 on Thu 23 Nov 117.