EST 1324748 is a singleton


Sequence

>1324748 (1 EST) Length=328 CACCGGCTGTAAGTAAGGTGCGCGGTTATCGCTATCAGTTCTGCTCGGTGTATGTGAATGTTCACTTTCTGCATACAAAA AAATCGAATAAAATTACAAAAATTCTCGTGCCGAATTCGGCACGAGCTGTTTTTTTCGGATCCTTATTTTGAATACCCGA ACCTGAATGTCGTCTTATCCCATCTTTTCAGTTCAACACAATTCTAGACACTCACGCTTAGTGATTTCCAATTTTATTCG TATCGTGTAACAGCTCACTGTTCCATTAAGGAAACTTTTTGTCATTTATCATATTAGTAAGAAATAAACAGCCAAATTTT TATTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1324748: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13247482539391AA627004MBAFCW2D05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 9:15:19 on Sat 18 Nov 117.