EST 1324777 is a singleton


Sequence

>1324777 (1 EST) Length=500 GGTGGCGGGCCCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGGTCTCTAACTTTATTGTATTTTAC ATGTATTTAGGATATGTGTGTGTGTATGTTTAAGTGCTGTTTCTTGATTCCTGTTTATGCAATAATGCTTATCCACATTA TTTCGTATTTTAATCTTTCCTTTTAAAAGGCTTGCTCACTTATGTTATAAATTCTAAAATATTGCTTATGTGTCGCTTTT TGTGCTTTTAGCGTATTTAGTGCGTTTTTCATGATGAAATTGCAATTTATTAGATGTATAATCTGGGTTTTTTCTCAACA TTACTTTCAAAGTTATCTTACACCTAACGTCAGTACTCTCGCTGACTGATGGTGGAAGAAAGTGCTCAAATTCTTCCTTG ATTCTCTTTGCTTTTCAATGTTGAATGGGAATAGAGATTAATCTTGTCTAACAATTTCACTTTTCCAAAAACTTTATTGA AGTGTATCTAGCCCGGTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1324777: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13247772539420AA627033MBAFCW2G03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:11:24 on Fri 17 Nov 117.