EST 1324779 is a singleton


Sequence

>1324779 (1 EST) Length=427 GGTAATTGTATGACAAATTGATTTCGATCCAAATATCGTTGCTGTGCTGCTTGTATTCGTTGAAGTGCATGCCGAAGAGT CATCCGTAAATATGGTTGTTGAATAGCTGATGCTGATGATGGCATAAACATTTCTTGAAGTTCATCTGCACTCATATTCT CAATGATTCGTCGAGATGAATCTGAGATTGCGTATTCCCGTGTCAATAATTCCGGAATTGATGGCACATTCTGGTCGTAT GANAAATGTATCCTTAATTGTTGCGGTGATTGAGAAAGTATTTGTTGTTGTGATGTATTTTCTCCTTCTTCTTGAGTTAC ACGAAATGTTTCTCGAGATGATTGCTCAGACATTTGCTGACAATCAATTTATCCGTAACGGTAATCCCGTAATTGTTTAC ACCGGTTATAGATAAACTGCGCAAGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1324779: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13247792539422AA627035MBAFCW2G05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 21:52:17 on Fri 17 Nov 117.