EST 1324783 is a singleton


Sequence

>1324783 (1 EST) Length=476 AAGTTCCCGTAATTATGCATGTGGAAGACACAAGGGGTGACACAGACAATAATAACTCCTTGCAAGTGCCACAACCGATC GCTACCATTTATTCCACTTCTCCAACACTTCCTCAAAGACGGAGGAATCAAGTGAGAGAAGGAGATAAAATAAGCGTATC TGTAGCTGTGGTTGAGCAGATTGAAGTTCGACCAGAAACATTGGAAATCTCCAGTATCGCTTACATGATCTTGTTTGGCT CCTCAGCTAATAACTTCGTTGACGGAATGAGTAATGGGGTTGCTTTCGCGGATTCTTTGGGTCGTGGCCTCAGTATTGGC ATTGCATGTATTGCGCAACAATTTCCGCAAGAATTAGGTACTCTTGCTATTTTAGTTCAATCAGGACTGGGTCTTAAGAA AACATTACTATTGAATTTAATACCTGGTGGCTTGAGTTATCTTGGATTCACCATCGGAGCACTATTGGATGATTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1324783: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13247832539426AA627039MBAFCW2G11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:19:15 on Fri 24 Nov 117.