EST 1327215 is a singleton


Sequence

>1327215 (1 EST) Length=468 AGAACATTTAGTATTTGGACCTACTAAACCAGAGAAAAAGTTGACAATTGAACATGAAAAAAATTTAGTAGACCAATTGT ATGAATTATACTCTGCTATGTCAGTTGCTGAAAAACGTTCAGTTAGTAGTAAATTACTATCAAGAATTAATGAGATTCAA AAATATACCGATCCAAATTTCATGGAAGATGATACACTTTTGGCTCAATCTAAAATTGAAATTATTTTAGCTCAACGAGA CAGAATAGAGAAAATCGGCAGTGATCTTGAAAAGATTTCAAAGTTGCGAGATTGTTTAAATCATCCAGCATTTGGGGAAA TTAGTACGTTAAAACAAAAGTTTGAAGATCTACGAATGGTACATAATGATCAATATGTTATGTCTGAGAAGTTGATCGCT GATACTCAAGCTTTATTGGACACATATCATAATTTGATACGTGATACATCTAAATTATTCATATATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1327215: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13272152546879AA629471MU000101.Y2RSmL


Date: 21:8:54 on Fri 24 Nov 117.