EST 1327754 is a singleton


Sequence

>1327754 (1 EST) Length=360 CGAGCTAAGTTGACGATTGTTGTTGGTAAGTTTTGATATTTCTATATCGTTACGTAATTAATAATAGATCTGGTTAACAT GGTTCTTTGTTTACTACTTTTTCTTTAGTATTCATTATCTTAACTATTCATAGTTTTCTACTTCTGTGTATATTCATCAA CTATTTTTTTTCCTATACCTGAGTATATGGGTAGATGATGATATGCAGATGTTGAATTGCATTTGTCTTTACTTTTCCAC GTTATTTCGTCTGTTTCACCGCATATTTTCGACTTCATTTATATTTTTACTGCTTTCCTTTCTCGTAACTCATTGTGAAA TTGTCATCATTTACATACTTTTAATTTATTTATATCTACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1327754: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277542552091AA629480MU000034.Y2RSmL


Date: 6:10:42 on Sun 19 Nov 117.