EST 1327756 is a singleton


Sequence

>1327756 (1 EST) Length=406 CGAGACAGCCTATCAAAAACGTNAACTATGGAAACAATCCCGCTTGAGTCAAGATGAAGANTTTACATTAGAGAATTCAA ATTTACCAGACAAGATGCTGTCACTTAGTTCGGAGGATGATCGTAAACTTGCACAGTCAGCACAGATGTATCACTATCCN ACATCAAAAGCANCGAATGTTAGCTCTAGAAAAAGTTAATGATCATNCTTTANTAAGTGATGAAGATGACTGTGAAGATG ATGTGGATGATGGAGATTTTNCAGTTTATGAATGTCCAGGGCTCGCTAATNCTGGTGAAATCGAAGTCGAAANTCCTTNC TTTGATNGTGATAATNCTCCAAAGAATAATAACGATAATAATAATCTGGTGGAGAGANAGCGTTGAATACNANTGGCNGC TCANGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1327756: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277562552093AA629482MU000033.Y2RSmL


Date: 2:30:4 on Wed 22 Nov 117.