EST 1327757 is a singleton


Sequence

>1327757 (1 EST) Length=229 AAGCACTCACCGAGTGAAAAAGACTGGAATAGTGTATATTGATGCAAATATGAAAAAGAAGTGGACTGANNTCACTATCA CGAAATAAAACGTCATCAGAAAAGGCCCCCACTCTTTAAGTTTGGATAATATATACGGAAGGAGATTAGCTGACNTGTAG ATTTGCCCAATCCTTGGANACCCTTGANAACTTTGGATNCNTNCGAAAAACTGGATAGATTTNGATTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1327757: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277572552094AA629483MU000035.Y2RSmL


Date: 0:43:38 on Fri 24 Nov 117.