EST 1327762 is a singleton


Sequence

>1327762 (1 EST) Length=354 CGGTGGAATGTGCGGTTCGGCCAAAACGGTGTCAGCCAAACGGCATTATCACCACTANAAATTTATAGCCAAAGTAAATA ACAGCGTAGGAAGGAAGGTAAAGACCATTGCCNGGTATAAGGACCCTAAATCTAAGGAATTACCGAAAACACAATCACAA TTCNCGTANTTATGTACTCAACAGGGGAGCCAACTACTCTACAAAAACAANTGCTCTCTCAGCATGTCCGAANATCNTCT AGTATACAGACGGACTGTACCCCTCTGCTGCCCGACACACAAGCAGCNTNTGTCTCCTAAAGCTTTAAGAATGGTTATGC TGTCCAGGGCCTTTAAATACATGTTTCCCTCCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1327762: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277622552099AA629488MU000050.Y2RSmL


Date: 14:51:12 on Sun 19 Nov 117.