EST 1327766 is a singleton


Sequence

>1327766 (1 EST) Length=241 GGAATTCGGCACGAGCCTCACCAAATTCCTTTTTCATGGATGTTAAGTGTTCAGGCTGCCTAAAAATCCAGATTGTTTTC AGTCATGCACAGACAGCTGTAGTTTGTCCTGGATGTGACCGAATTCTATGTCAGCCCACTGGTGGTAGAGCACGGCTGGC TGATGGATGCAGTTACCGCAAGAAGGCGAAATGATTTTCTTGTAAATTCCGATTGTTATAATAAACTTATGGAAACAATT T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1327766: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277662552103AA629492MU000059.Y2RSmL


Date: 22:14:49 on Fri 17 Nov 117.