EST 1327769 is a singleton


Sequence

>1327769 (1 EST) Length=286 GAAATTCGGCACGAGGGAATTTGGAAATATCAAACGTTCTTATTAAAAAACTANCTATTCACAATGGCGATNCTTAATGA CTTATCTAGGATGCATTGTGGCCGTGTCATATGCACTGCTTTTGGTTGCTTCAGTAATACTTATAGCTATTGGGGGGAGC ATACTTGTAATTGCTGCNCGTNACAAACACNTTGTGACTGTGACAAACTTACAATTTCCTGGTTATATTGTGCTGGGCAC AGGATTATTGCTCCTGTGTGCTGGAGTGATTGGTTTCATAGCCTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1327769: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277692552106AA629495MU000065.Y2RSmL


Date: 13:25:25 on Fri 24 Nov 117.