EST 1327770 is a singleton


Sequence

>1327770 (1 EST) Length=339 GGAATTCGGCACGAGGCTACATGTCAAAAATATCGTTTAAAATCACTCTAACTTCAGATCCTAATTTGCCTTTCAAAGTA CTAAAGGTCCCTGAAAATGCACCATTTACTGCTGTCTTGAAGTTTGCTGCTGAAGAATTCAGCGTACCAGCAGCGACAAG CGCTATTATCACAGATGATGGGATCGGTATAAATCCTCAACAAACAGCAGGTGAAGTGTTTCTTAAACATGGATCAGACT TGCGATTAATTCCTAGGGATCGTGTTGGTGGCCTGTGATATTCTTCTTTCCTTGTTTATTGTGGTCATTTTGTATGTCGT ATCTGTTTTTATTTATCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1327770: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277702552107AA629496MU000072.Y2RSmL


Date: 1:7:48 on Tue 21 Nov 117.