EST 1327772 is a singleton


Sequence

>1327772 (1 EST) Length=323 GGNAATTCGGCACGAGCTGCCGTGTAATTTGGTTTCAGTGCATAATGGATGATTTGCAAACATCTGAAGAGACAACCTTT GTCCAAGACGAAGTAGAAAACATAGTTAAAGAGAGCATAGAAGGCATCATTGGTTCTAGTTCTTATTCACATAATAAAGT ACAACAGTGGACTTCGTCTGTGATTGAACAATGCCTCAGTCAGCTGACTAAACTTGGAAAACCTTTTAAGTACATCGTCA CATGTGTAATAATGCAGAAAAGTGGAGCTGGACTACATACTGCAAGCTCTTGTTATTGGGATAGTACTACTGACGGGAGT TGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1327772: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277722552109AA629498MU000074.Y2RSmL


Date: 2:26:40 on Wed 22 Nov 117.