EST 1327773 is a singleton


Sequence

>1327773 (1 EST) Length=469 GGGAAGAGTTGAGTGCTTCAGTTATGGAGGTCAAAGAAATTCACGGCTTAGGGACTACGATCGATGTAATTGTTGTTAAT GGTCGACTTCATGAAGGAGATACTATCGTCTTGGCTGGCCAGGAGGGTCCTATATGTACTCAAATCCGCTATTCTTCAAC CTGCTCCTATGTCCGAACTTCGCGTCAAAGGAAGTTACAATCACCTGAAGGAAGTTATGGGAGCTCGNGGTGTGAAGCTT ATCGCTAAAGATTTAGAGAAAGCACTAGCAGGTCTTCCACTGTTTGTGGCAAATGGGTTGTCAGAAGAATTGTATTACCA GGAGGAAGTATGTCGTGGTTTAAAGCATGCCTTAAAAGCTATTTCTGTCAGTCCTTTAGGTGTATATGTTGTTGCTAGTA CACTTGGATCATTGGAATCTTTATTGGTGTATTTGAAATCTGTTGATATACCGTATTCNGGTNTCAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1327773: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277732552110AA629499MU000076.Y2RSmL


Date: 5:51:30 on Sun 19 Nov 117.