EST 1327774 is a singleton


Sequence

>1327774 (1 EST) Length=487 CGCCACGAGAAAAATTTAAAATTAACATCAAATTCTAAATGTTATGCTGTTGGTTGGGGTAGTAATAAAGGTGGTAAAAT ACCAACATTTGATAATATACATAGTATATTAGAATCATTATTTTTACCATTTCCATCATTATTTAATACACCATTTACAT TTGGTAGAAGAGAATCATCTATATGGAATATTAAAAAATTAGAAGAAGAAGAATCATCTAAAGAATTACATGAAGTTGAA TTACCTATAGTATCTATAGATGATTGTCGTAAATATTATGCTGATATTAGTTCAAAAGTACATGTATGTGCTGGTGCTAA AAATAAAGATACATGTGCAGGTGATAGTGGTGGTGGTCTTTATTGTTATTTAGAANATACTAATCGTTGGCATATTGTTG GTGTAACAAGTTTTGGTTTAGCTAGANGTTGTGGTTTAAATCCTGGTGTTTATACATCAACATCATCACATATGGATTGG GATATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1327774: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277742552111AA629500MU000079.Y2RSmL


Date: 2:46:59 on Sat 25 Nov 117.