EST 1327775 is a singleton


Sequence

>1327775 (1 EST) Length=480 CGGCACGAGTTTTATTCTGCTGTCAATTTTTTTTAAAATCCAAAAATGTAACTGACTATTTTTATTTGCTTGTTGATAAC TTTTGTTTTCTCGTTTCTCCTTTTTCATTTGATATGATGATTCTTGTAGATTTTCGAGAGGTGTCATTATCACCAACTCT TCATTCATTCATGTATAGGTATGTAGCTTCTTCTTTCTTTTTTTTCTTCGAAAAAAAGAGGACATTCAACTTTATCTTAT TTTTCTCTTCTTTTGATTTTGTTTTCTCTAATAATTGACCGCGTCAATGTCATCGTGGAATCATATTGAATATTTTGGAT TTTTCCTTTATTGAGCTAAAAAAACATCTTGAATGTGTACTCTAAGCTGAGGATAATGTTGAATTGCAAATATTCAGTTA TTGTCGTTATCGTATTCCCTGTACAAAATTGTCTCTTTTTGGGATTTTTCCTCGGTTTTGGTAAATTAGAAATCTTCACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1327775: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13277752552112AA629501MU000081.Y2RSmL


Date: 18:15:43 on Fri 17 Nov 117.